An STS in the human T cell receptor gamma locus (located at 7p14-15).

The human T cell receptor gamma locus has been extensively characterized (for review, see ref. 1). The locus which covers 160 kb of genomic DNA is located at 7pl4-15 (2-4). It comprises 2 constant genes, 5 joining segments and 14 variable genes all of which have been sequenced (1). The variable gene TCRGV9 belongs to the V7II subgroup and is the single member of that subgroup. We have defined this information gene as a sequence-tagged site (STS), designated TCRGV9 [/7pl4—15] for inclusion in the human genome map. Using the polymerase chain reaction (PCR) described below, a fragment of the expected size (427 bp) was amplified from human genomic DNA. The fragment contained sequences from positions 1 to 427 of the human TCRGV9 gene (5). The amplified fragment was purified, uniformly radiolabelled, and used to probe a human genomic Southern. As anticipated, a single 4.8 kb Sac I, 2.2 kb Hind HI and 5.2 kb Eco RI fragment were detected, demonstrating both the unique character of the amplified sequences, and the direct utility of the PCR product as a probe for retrieving clones containing this STS from libraries. PCR primers: Forward (1—21 in ref. 5) CTGCAGACATGCTGTCACTGC Reverse (427-408 in ref. 5) GGTGAGAGTGGATGTAGACG PCR components: PCR profile: 2 /tg of human genomic DNA, 40 pmoles of each nucleotide, 200 /tM dNTPs, and 2.5 U Taq polymerase (Perkin Elmer Cetus) in 100 /tl of 1 xPCR buffer (50 mM KC1, 10 mM Tris-HCl, pH 8.3 (at room temperature), 1.5 mM MgCl 2 , 0.1% (w/v) gelatin). 94°C for 5 minutes 65 °C for 10 minutes 72 °C for 2 minutes 91°C for 1 minute for 30 cycles 65 °C for 1 minute Anticipated sequence of the PCR product: